List of Y-DNA single-nucleotide polymorphisms

List of Y-DNA single-nucleotide polymorphisms

Mutation number Nucleotide change Position (base pair) Total size (base pairs) Position Forward 5′→3′ Reverse 5′→3′
M1 (YAP) 291bp insertion
M2 A to G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc
M231 G to A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg
M241 G to A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M242 C to T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M253 C to T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt
M267 T to G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M285 G to C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M286 G to A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M287 A to T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M304 A to C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt
M335 T to A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta
M339 T to G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt
M340 G to C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa
M342 C to T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact
M343 C to A 402 424 tttaacctcctccagctctgca acccccacatatctccagg
M349 G to T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct
M359 T to C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt
M365 A to G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M367 A to G 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M368 A to C 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M369 G to C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M370 C to G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg

See also

External links

  • Sequence information for 218 M series markers published by 2001
  • ISOGG Y-DNA SNP Index - 2007
  • Karafet et al. (2008) Supplemental Research Data